Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:166-e2_T3   

cenix:166-e2_T3SequenceCGGTGAGGACATTGACGATA
Length20
In_sequenceF28F8
PCR_productcenix:166-e2