Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:170-a12_T7   

cenix:170-a12_T7SequenceTAATCGATTCTGCTGTCCCC
Length20
In_sequenceY62E10A
PCR_productcenix:170-a12