Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:181-h12_T7   

cenix:181-h12_T7SequenceTCGTTCCTCAAGGATTCTGC
Length20
In_sequenceC25G4
PCR_productcenix:181-h12