Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:186-e7_T7   

cenix:186-e7_T7SequenceCCTTTCGAAATGGTCAGAGC
Length20
In_sequenceM7
PCR_productcenix:186-e7