Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:192-f7_T3   

cenix:192-f7_T3SequenceCCAGGTCGCAAATCAAAGTT
Length20
In_sequenceC06E7
PCR_product cenix:192-f7
cenix:192-f7_1
cenix:192-f7_2
TH:192-f7