Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:236-f2_T7   

cenix:236-f2_T7SequenceCATGTTGACTTCAACCCAGTG
Length21
In_sequenceY62E10A
PCR_productcenix:236-f2