Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:238-e9_T7   

cenix:238-e9_T7SequenceGAAGAGACAATCACCACCCG
Length20
In_sequenceY62E10A
PCR_productcenix:238-e9