Oligo: cenix:26-c10_T3
| cenix:26-c10_T3 | Sequence | TCCGCATTCTGGACATGTAA |
|---|---|---|
| Length | 20 | |
| In_sequence | ZK546 | |
| PCR_product | cenix:26-c10 |
![Adult](JavaScript:void
window.open("/cgi-bin/rnaidb/popUpImage.cgi?imgName=N2wormfinal.png",
"RNAiDB Help","toolbar=no, location=no, directories=no,
status=no, menubar=no, scrollbars=yes, resizable=no,
copyhistory=no, width=1000, height=550"))
 |
Please provide feedback if you are experiencing any difficulties with this website. |
| cenix:26-c10_T3 | Sequence | TCCGCATTCTGGACATGTAA |
|---|---|---|
| Length | 20 | |
| In_sequence | ZK546 | |
| PCR_product | cenix:26-c10 |
|
Please provide feedback if you are experiencing any difficulties with this website. |