Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:308-f4_T3   

cenix:308-f4_T3SequenceAAAGGGAGGGATATTGTGTTGTT
Length23
In_sequencePAR2
PCR_productcenix:308-f4