Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:341-b2_T7   

cenix:341-b2_T7SequenceGAACCAGTTGTGATGGGTGA
Length20
In_sequencePAR2
PCR_productcenix:341-b2