Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:40-a11_T7   

cenix:40-a11_T7SequenceTGTCCATTTTGATAACCGCA
Length20
In_sequenceF28F8
PCR_product cenix:40-a11_1
cenix:40-a11_2
TH:40-a11
cenix:40-a11