Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:58-c4_T3   

cenix:58-c4_T3SequenceTGCATTCTCCACTTGTTTGC
Length20
In_sequenceB0395
PCR_productcenix:58-c4