Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:58-d9_T3   

cenix:58-d9_T3SequenceCGACAGAAAGCACCAGGTTT
Length20
In_sequenceC06E7
PCR_productcenix:58-d9