Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:66-d12_T3   

cenix:66-d12_T3SequenceTTTCAGGGAGAAAATTCGGA
Length20
In_sequenceY62E10A
PCR_productcenix:66-d12