Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:80-f6_T3   

cenix:80-f6_T3SequenceAACCAATTGTCGCAAACCAT
Length20
In_sequenceW07E11
PCR_productcenix:80-f6