Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:89-e2_T7   

cenix:89-e2_T7SequenceCTTCCGAAAATCTGGAGCTG
Length20
In_sequenceY6E2A
PCR_productcenix:89-e2