Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:90-c11_T3   

cenix:90-c11_T3SequenceGTGAGAAGCCTCAATCGACC
Length20
In_sequenceY119C1A
PCR_productcenix:90-c11