Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:92-g3_T3   

cenix:92-g3_T3SequenceGAACGAATTTGGTTTTCGGA
Length20
In_sequenceY62E10A
PCR_productcenix:92-g3