Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: cenix:93-g8_T3   

cenix:93-g8_T3SequenceCGCATCAGACCAGAGTTCAA
Length20
In_sequenceC47E12
PCR_productcenix:93-g8