Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_AAB25489_b   

mv_AAB25489_bSequenceCATAGCGTACTTTTGCGTCCAT
Length23
PCR_productmv_AAB25489