Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_AAC08938_b   

mv_AAC08938_bSequenceATTGGAAGTCGTAATCTGGCAGCGG
Length25
PCR_productmv_AAC08938