Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_AAC08939_b   

mv_AAC08939_bSequenceATTGGAAGTCGTAATCTGGCAGCGG
Length25
PCR_productmv_AAC08939