Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_AAC08939_f   

mv_AAC08939_fSequenceTGCAAGTTTCTGGAATCCTATC
Length22
PCR_productmv_AAC08939