Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_C25A1.13_b   

mv_C25A1.13_bSequenceATTTTGGTGGATTTTGAAGAATATATTCCGTC
Length32
PCR_productmv_C25A1.13