Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_C25G4.4_b   

mv_C25G4.4_bSequenceATTGAATATGACTAGGTCCTGGAA
Length24
PCR_productmv_C25G4.4