Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_F10C5.1_b   

mv_F10C5.1_bSequenceAAAACGAGAAATCATCCTCTCCCT
Length24
PCR_productmv_F10C5.1