Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_G_YK3818_b   

mv_G_YK3818_bSequenceAGAGAGCCTCGATTCTCTGATT
Length22
PCR_productmv_G_YK3818