Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_G_YK3818_f   

mv_G_YK3818_fSequenceTGGCTGACACTCGTGAGCTT
Length20
PCR_productmv_G_YK3818