Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_G_YK5760_b   

mv_G_YK5760_bSequenceAGGCCCAAATTCCGTCAGCA
Length20
PCR_productmv_G_YK5760