Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_T02C12.2_b   

mv_T02C12.2_bSequenceAATCATCTTCTTGTTCAAAATCTCC
Length25
PCR_productmv_T02C12.2