Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_T02E1.3b_f   

mv_T02E1.3b_fSequenceTGCTTTATCAACCATCTTTGTTAAAAAGT
Length29
PCR_productmv_T02E1.3b