Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_Y111B2G.i_b   

mv_Y111B2G.i_bSequenceATTGTGGAGATGGTGAGCGAGAT
Length23
PCR_productmv_Y111B2G.i