Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_Y119C1A.1_f   

mv_Y119C1A.1_fSequenceTGCCTCATCAACCAGTGCTTCTGAAT
Length26
PCR_productmv_Y119C1A.1