Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_Y48C3A.2_b   

mv_Y48C3A.2_bSequenceAATACTTTGTCGCGTATCCGTT
Length22
PCR_productmv_Y48C3A.2