Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: mv_ZK546.6_f   

mv_ZK546.6_fSequenceTGACCCAATCCGTCCCACCAG
Length21
PCR_productmv_ZK546.6