Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_AC8.6   

sjj_AC8.6RNAiSimmer:AC8.6
PCR_productsjj_AC8.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSAC8.6 Source_evidenceePCR441WS150 Sequence/Annotation Release
Overlaps_Gene AC8.6 Source_evidenceePCR441WS150 Sequence/Annotation Release
Chunk_score Abs_score399
Max_abs_score399AC8.6
Specificity_index0.542
Rel_score1
Map_statusUnique_ePCRX216975217775
Y110A7A.19 Chunk_score Abs_score337
Specificity_index0.458
Rel_score0.845
Overlaps_transcriptAC8.6 Source_evidenceePCR441WS150 Sequence/Annotation Release
WB_DNA_textsjj_AC8.6801cttctcattctctcttcggtgaattggctgaactcaacccaaactgcaaccaatttttgggacaagagatgtgaattgctcccgttcactagttcccaatgtctgaaaaaaacttgtaaaaaacacaagatatttggaaataaaacttacatgtagctgtacattacacaactgtttgcgcatttcttctccaataactccattcatctgtccagctgcaataccgtcgatgattactctccgtaacagtggccaatgacgatcggaggatgcagcgagttttcgaaaaactagtgatgacagataattgttgactccaactagtcgtggtaccatggtggtgtacaaatcataaattctgttcagtgaagcactttgttctacagccaattgtaattgtctattatagaacattgattcaattgtgaatgcaggcatctttacttcgtttgttttggattcataaattgaaacaagattttctgcgaggttctcatttgcagctctgtaatggattcccattgcttcgacgaagaaaaaaatcgtgtcgtttcgtggaattcaaagatgtagttggaagttggatgttcggcaggcaaaggaaaatatcggaaattcgatggatttttcaccgaccttggcttgaagatgtgattgtgctggacgatttgtgcagcttttccgattcaacgtgcacaagttatgactccggaagacgaagaggaacagtcgaagatgacaagaaatacggatgtcgtcgtggatctagaagaacgccgagcacatttgcaacattctgta