Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_AH6.5   

sjj_AH6.5 RNAi JA:AH6.5
Simmer:AH6.5
PF:GL1_4E2
PCR_productsjj_AH6.5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSAH6.5 Source_evidenceePCR710WS150 Sequence/Annotation Release
Overlaps_Gene AH6.5 Source_evidenceePCR729WS150 Sequence/Annotation Release
Chunk_score Abs_score624
Max_abs_score624AH6.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII95248889525807
Overlaps_transcriptAH6.5 Source_evidenceePCR729WS150 Sequence/Annotation Release
WB_DNA_textsjj_AH6.5920tcgacaatcacaacgacgataccatgagtgctgagaaggaaaatcgtttcaataaggttgctcttttttcccttcaagaattacatgatttttttcagaatcgtgttgagaaattgggtcgccgtgggttcgccaaaccagaagttgacagccaactgccacacaactttaagactcgtctttgcatgacgcacgcagctggaattaatccttgtgcattgggtgctcggtgcaagtttgctcatgggctcaaagagctcagagcttctgatattgtgagtttaattccattttatctcatagaattcaaaatgtcgttttcagccgactcgttatccgaacaataaatacaaaactaaattgtgcaagaattttgcgcgtggaggatctggagtttgcccatatgggcttcgatgcgagtttgttcacccatcggatacggaattccagaatattcctccatatgtacgtttccattcgattaagcatttttaacaaatatttattatttttcagcaacgtaagatggtcgaggaacacgattctattccggaagattacgttgtagctagatatcagccacgattcatgcataccagtggaaaggctacgactccaacgaaggtcaccctcaagcaacgaaatgtggctgggtaaataaatatatttcaaatgactgttcttcaataccttcattttcagttccatgatgtgcctctccaatactggacgcgatttagaggcaggaggtgatttcaaccatccggaaatcaatgaaaacgatttaccaccacacttgagacggattcgcagaggcaatccacctgtaaccagaagtcgtccatctttcagtacgaaatggacatcagtggagaacctcggtctgcgaggacactattagggcgtactttaccactcca