Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0035.11   

sjj_B0035.11 RNAi JA:B0035.11
Simmer:B0035.11
PF:GL1_5A4
PCR_productsjj_B0035.11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0035.11 Source_evidenceePCR907WS150 Sequence/Annotation Release
Overlaps_Gene B0035.11 Source_evidenceePCR907WS150 Sequence/Annotation Release
Chunk_score Abs_score802
Max_abs_score802B0035.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV1132797711329077
Overlaps_transcriptB0035.11 Source_evidenceePCR907WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0035.111101ttctggatgacgttggcatatcttcatcatcagaatattgtcctgcatatctcggaccacgaactttaaagttattccgaaccatctgagtacgtcggatgtgtgcacgaagtgattcttcctccttccgggcattctcacgccgtgtaatttccggattctgaccaacatcgtccatgactttaacttgagcattcttcctgcttcgatctgccatattgagtgtgacttttctgtgagtttgggaatcagtcgagtgaggacggaaggtcatacgatgtgtaagaacagcttgagccgactaaaaatgacataaattttgattaaaataaaaacattaacaatcaaaataccattaatgttggctgcttaacgtaaagatggggaagattattggaattcagcggcaccaatgagacttcgaaaatttcgtttccgaggtatagagacattctgaaattaagtcacgatatggaaattttgcatcaattgaaaactaacgttccatcgtcccattttacaatttttgcattactctctcgaatttcttttccattttcatctttgcgaactcgccagcgaagtgtattttccaccttaaaaattgtatatttgatgagatgtatttataacacagacatactctcaatttgagacgtgttcgtccttcatcatccaatttcgcctgctcatcatcttcgtcttcctcgtaatgttgtggatcaaatggatgagtggcgactgatagaaagtttggcattctgacaaaatgtggtggatctgcagcgtactccaaagtaacacgacctgttaccatctggaaaatcaatgttttaatcacattatttcattgaaaatgtttacttcagtatcatgaacatgctcctttgctttttcatcttcatctatttcatctggattagccatcacaattccttgcaaatcattcaaacttccacgactctccgcatcggaatctgacaatcgtgctcttgtatttgattctttcggctttccttctctgtcggaatcatcgtcggaagagccagagagatcaccgaacaaaccaccaccagcaccgggggaactcttttcacctcc