Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0035.7   

sjj_B0035.7RNAiSimmer:B0035.7
PCR_productsjj_B0035.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0035.7 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene B0035.6 Source_evidenceePCR121WS150 Sequence/Annotation Release
Chunk_score Abs_score100
Specificity_index0.049
Rel_score0.26
Map_statusBottom50_percentile_ePCRIV1132347511324577
B0035.7 Source_evidenceePCR384WS150 Sequence/Annotation Release
Chunk_score Abs_score342
Specificity_index0.167
Rel_score0.891
Map_statusBest_ePCRIV1132347511324577
F17E9.13 Chunk_score Abs_score113
Specificity_index0.055
F08G2.2 Chunk_score Abs_score121
Specificity_index0.059
Rel_score0.315
ZK131.10 Chunk_score Abs_score100
Specificity_index0.049
F55G1.10 Chunk_score Abs_score165
Specificity_index0.08
Rel_score0.43
T23D8.6 Chunk_score Abs_score170
Specificity_index0.083
Rel_score0.443
F54E12.5 Chunk_score Abs_score363
Specificity_index0.177
Rel_score0.945
H02I12.7 Chunk_score Abs_score384
Max_abs_score384H02I12.7
Specificity_index0.187
Rel_score1
ZK131.6 Chunk_score Abs_score83
Specificity_index0.04
Rel_score0.216
F35H10.1 Chunk_score Abs_score113
Specificity_index0.055
Rel_score0.294
Overlaps_transcript B0035.6 Source_evidenceePCR121WS150 Sequence/Annotation Release
B0035.7 Source_evidenceePCR384WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0035.71103gacttcgggattaattgttttccctctgaattttttataatttttcccgatttattctacctcaccgtgaacattttaaccccttaattatcccatgagaccgctcatttttataaaatcggtaggacgcgaatttctttgtttattatggcattgtgatatagtgggggatggggtggtatgcagggcttagctcatggttttccttagttttctgaccgatcgtcaaatataggtgaaaacttaataacaatattgcattcagggctcgaatttcaagcagaccgcttataaatgcaatacaaaatttattaaaatgggattgaaaaattgtaattatcgtaattctagaatttcctcatacgttttctgacagaacatggaaggtagaaaactttataacaatattgcattcaagcaaacaacttattaaaaataaatgtaatatgaactttattaaaaaatttattaatgggaaaaagtaggattttgtatatttgtggccctaaagaggccgttgggttcggtgggtttgtttaaagaagaaagttcttactccttatctcctccagtcttctttgggagaagaacggcttggatgtttggaagaactcctccttgggcgatggtcactccggccaaaagcttgttgagctcctcgtcgttgcggacagcgagttgaagatgtcttggggcgatacgggtcttcttgttgtcacgggcagcgttaccggccaactcgagaacctcagcagcgagatattcaagaacagcggccaagtagactggggctccggctccaacacgttgagcatagtttcctttgcgaagaatacggtgaagacgaccgactgggaattgaagtccagctcttgatgagcgtgacttggcctttcctccggtcttggctttgcctccctttccacgtccagacatgatgagcgattggtgttcgtaagacgaatctgaagaatgaatcgaaactgtctgtttatattcatttctacggtggaggggcggagtttcatgcggggacacctctatttgaacattccgcactctctggtaggacacatttctctcacttctctttgtccccctat