Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0035.7   

sjj_B0035.7RNAiSimmer:B0035.7
PCR_productsjj_B0035.7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0035.7 Source_evidenceePCR384WS150 Sequence/Annotation Release
Overlaps_Gene (11)
Overlaps_transcript (2)
WB_DNA_textsjj_B0035.71103gacttcgggattaattgttttccctctgaattttttataatttttcccgatttattctacctcaccgtgaacattttaaccccttaattatcccatgagaccgctcatttttataaaatcggtaggacgcgaatttctttgtttattatggcattgtgatatagtgggggatggggtggtatgcagggcttagctcatggttttccttagttttctgaccgatcgtcaaatataggtgaaaacttaataacaatattgcattcagggctcgaatttcaagcagaccgcttataaatgcaatacaaaatttattaaaatgggattgaaaaattgtaattatcgtaattctagaatttcctcatacgttttctgacagaacatggaaggtagaaaactttataacaatattgcattcaagcaaacaacttattaaaaataaatgtaatatgaactttattaaaaaatttattaatgggaaaaagtaggattttgtatatttgtggccctaaagaggccgttgggttcggtgggtttgtttaaagaagaaagttcttactccttatctcctccagtcttctttgggagaagaacggcttggatgtttggaagaactcctccttgggcgatggtcactccggccaaaagcttgttgagctcctcgtcgttgcggacagcgagttgaagatgtcttggggcgatacgggtcttcttgttgtcacgggcagcgttaccggccaactcgagaacctcagcagcgagatattcaagaacagcggccaagtagactggggctccggctccaacacgttgagcatagtttcctttgcgaagaatacggtgaagacgaccgactgggaattgaagtccagctcttgatgagcgtgacttggcctttcctccggtcttggctttgcctccctttccacgtccagacatgatgagcgattggtgttcgtaagacgaatctgaagaatgaatcgaaactgtctgtttatattcatttctacggtggaggggcggagtttcatgcggggacacctctatttgaacattccgcactctctggtaggacacatttctctcacttctctttgtccccctat