Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_B0035.7_b   

sjj_B0035.7_bSequenceATAGGGGGACAAAGAGAAGTGAG
In_sequence H02I12
F54E12
PCR_product sjj_B0035.7
smd_F54E12.5
smd_H02I12.7