Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0041.6   

sjj_B0041.6RNAiJA:B0041.6
PCR_productsjj_B0041.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0041.6 Source_evidenceePCR423WS150 Sequence/Annotation Release
Overlaps_Gene B0041.6 Source_evidenceePCR423WS150 Sequence/Annotation Release
Chunk_score Abs_score360
Max_abs_score360B0041.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI46519714653122
Overlaps_transcriptB0041.6 Source_evidenceePCR423WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0041.61152agtggaattggaataaacagggtttttgtaaatgttgatgatcagaatctgctgttacaacaacacatatagttattttttccgggcgtttgtcgtcgacagtttcgaaacaattaatccgattaaatctagactttttttggaaacacgctctattgctaaaaggcttgaaaaattggttttatggttttattcaaaaactatttatttcagaaattaacatcctttataagtgaaaatattcttgggtgtctcctcaattgtcactttatacaaaaccgatggattcgacattacggatttcagcttctcgaacatataaattgccacgttttcagatgtgctcacagttgtctgaaattggaaaaaagtatttatcttggttttgaaacgcgaaattgcggtcttgggtccttccgaaattttttatgataacaaaaaaaatttaatttagatttttttcaatagcaaaattctcgaatcttttaaacaaaaaacatttaaaccatactagatggtactgtagctgaaaagtttcgctcgtgccaagacccacactttgaatagcatttttaatgacgcataatctgtctacagtaccttaaaaaattccacgtctttatccaaattcctgtgatctaccgtatccagcactaaactcatttcttttttcagctttgccaggtcatacaccattccactcgtcggatcaacttctccgcggagctttacctgaaatttttcgaaattatttttattttattaaaaaataaaatttttaaaccttccaaacataattatgtccatgaccatttgaattattgcattttccaaaagtttccttattttcagcgtcgctcagcttttcagagtgaagacgatgtgctgcggagaacgaatcgactcgttccatagttacaattggcattctgaacattcaaataatttattttattaaaaaaaagaaaaaaatggagaaaaatggaagaattatgtgtgttcaacgaataatttatatactggcgctggtgtttgcaaataattgattacaattatgatatgattgtcatcgtctctcttttcaactaatcatcttattacgacagcaggattatagtttctgcatcaaaatacgcaataatttcaagcgaa