Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0205.3   

sjj_B0205.3RNAiJA:B0205.3
PCR_productsjj_B0205.3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene B0205.3 Source_evidenceePCR776WS150 Sequence/Annotation Release
Chunk_score Abs_score713
Max_abs_score713B0205.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI1073103410732181
Overlaps_transcript B0205.3.1 Source_evidenceePCR776WS150 Sequence/Annotation Release
B0205.3.2 Source_evidenceePCR776WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0205.31148gagctccatccacatccatttgttcgtgttgtacttgtggctgctcagccggagcattttcctgcattgaaagacgaagagcccattccaattgttgctcttcagtcatcgctcccatgtccatttcttccaatggaacagcagcagccgcagcagcaacttcggcatcagctccagaatccgcggcacctccatttgcagcagcggcggcggcttgacgagctcgttcctcttccattgagacacgaagagcctaaaaagaataataaaatgattttccaacgcaaccaaaaaataatttcctactaaagccaaatctggatcattttcaacatccattccgaatgcattatccattccgtttccacctccaccgaatgcagcttgcccatcttcatttttgcatacacttgactgcaacaacgcgtctgtgagggaagatccttgtggaacaacgatcaaggatgagccgctgccttcttttccgttcaatgtgtccacgaatgttgagaatttctcatgtccatcggattcattttcaccgaacatgatgacgtcgcacagaaccttctctttcttcattttctttgcaatcttcacgagctcattcatttcaatttcctcgagaggtgatccgatgaagagaacaacgcgcatcttatgattacggttttgacgatgtttcagagcaagatgagcaatcttgataccggcgataaagttgcattttccgaatggctcaatggaatgattcttcatcatcaaacgtccttgttctgtggacagacttgacaatacttgaacactgctgaaaaggaaaacattgaaaaatttcatgtgttaccggaaatcagtgatttttgcgccaaaaaacggtactgggtctcgacaggacatttttcgctaaatacaaacggatgtgcacctttaaagaatactgtaacttcaaacgttgttactgaattttcatcgattttccaatgaaaattctagaacggcgaaagtttgaaactaccgtactcctcaaaggggcacacctttttgcatttaacaaaatatcttcgtgtcgagaccaggtaccgtcattttagcgcaaaaaaacgttcgagtttgagtaatatacgaactttgccattgacagaattcca