Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0207.6   

sjj_B0207.6 RNAi JA:B0207.6
Simmer:B0207.6:Screen_A
Simmer:B0207.6:Screen_B
PF:GL1_5A5
PCR_productsjj_B0207.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0207.6 Source_evidenceePCR807WS150 Sequence/Annotation Release
Overlaps_Gene B0207.6 Source_evidenceePCR807WS150 Sequence/Annotation Release
Chunk_score Abs_score723
Max_abs_score723B0207.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI59355055937165
Overlaps_transcriptB0207.6 Source_evidenceePCR807WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0207.61661tgcaaaaagcaaacaaaacgatttggtagaaaatctaggcttttgaattaagaataagttctcgaatatctccttgttcagttaatgagaatccatttgcagcatcaaccatttgaataactttcatcattgattccttattttcaacggcaagtggtacaaatgaaacgaggtcgaaatcgctaataactccacaaattgcttcattcaattttcgatatttttccaatccgggaacttcattcaaaagatccaaaagtcgattgacatcaggtaaatgggagaaaaactcgagatcataggtcccgtcttcagagaaaagatctgcttttgacagacagtttacttgtggcatctccattgttaccattgtcgctgaaattgaagctttttaatgaatataattttaatttgttcctttcagccacacaaaatttaaagtggttccgaatttcaattttttccatctaaaatcaaataaataacaaaaataggtttcagattaaatgaaagttttatgtgccagaaagatattgcatttcttagccagaaatacataaaggcccatggagtttcaaaattgtacagaacaaaaataaattttcattttttggaggaaatcagctgaattatatttggaaatttcgggtcgagagacaagaaaagtatttcaatttttttttaatcttaatgaactcttacctaatgtggataatgcaacagaaatgaatttcgatgggtcactgcagtaaagtgaatcggcaagatgtaaggcacatagtctaacaccggatttttccaaaaagcggataactttccatagttcgccttcgcttttgtatagttccaactgtccgggacaatcaattatcagatatttcttgtgattcgcttcgattttctgaaaaaagatttaattgaatattaaaactacaaagaggttaaaaatgatttccgattttctcgattcaaatttagagaattccagattttagctcaattgttgtgaaaacaatttttagcttttgagaattaactttttctgccaaaaaaattacctggaggagccaattacaattagctccaagtgtttcaatacagtatttgagagctccatttggtccaagtccaagtcgatccattacatcattcacagtgatcatttcctaaactttagtattttaaatgaaaaatatgaccttaagtattaaaataacattgatagatgatctgtaccacgtttcataattattgtcctatattcattggaataaaatacttacagtgatatttacatcaggtgcgtatgccattgtgtcattagcaggatcaagattgatagtgagaaatggtcgtttggtttgtgagaaaatgtccgttaatcctgcacaaaatgtagattttccagctccaggagctccaattacaagaactccgtacatagtccaatgagtactgaaattttctagttgaatcttaattttctacggattgttttgataggaaaacatttaagaagaacaaaaatatataaatacaatttaatttaatttaaaacaaacaaaaaagcaggataaacgggcctggcacagggccaagtacgcatttacaccgtacatgacgacatattgcggaccattgcattttgccgcgttaatttt