Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0207.8   

sjj_B0207.8RNAiJA:B0207.8
PCR_productsjj_B0207.8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0207.8 Source_evidenceePCR426WS150 Sequence/Annotation Release
Overlaps_Gene B0207.8 Source_evidenceePCR426WS150 Sequence/Annotation Release
Chunk_score Abs_score340
Max_abs_score340B0207.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI59509155951914
Overlaps_transcriptB0207.8 Source_evidenceePCR426WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0207.81000tctaaacattgtaggggctcaaacaagctatattgcactacttaaaaaagccaaaattttttgcaaaagtagcaatttatcaaaagttggatttcaaattctcaatgatctaaatgtttttgaattagaaaaaaggaaattcggatttccaccacaatattattagctttgttttcatttaaaacgaaaagtgaaatattgtaacataattttattttgtggcttacctgttaatttgcctacctcgtctatacataagatgccatttattttcatctaaaatctcattagttgaacgattctagaagttgccaaagatgaacatgtccggaaattgttcaacctaactatattttgaaaattaacaaatttcatagtattttcacaaaatccatttttaaattttacaagattttttttttgattattttgcacttctctaataatcttatacataaactctgaaaattgaaaatgcaaattttagttctctgggtctattaaagattgaaaaacatttattttaacatatggaaaatagtcaaaaccaacggagatgcaccacagaaaatcctggtaaaagactaataaaggaaaaacggattgcaaagtatgaaaaatgttttttaaagatatcgaaaagaaaacgtgtatatggctcactgaaatgttttttattaaattgaattttcttgagcacttgacaattcatcaaatatagaaatatctcaaagttatacaaaatcataaattgatatgaatattgtacacgagaggcaactttctgcaaagttgaaagtttaacctttaacctaatgtcaaatgaccatctattaatgacgaaatgctaatttttctgaccaaaaaaaatcctagaagctagaaagttgatcatcacaaatctcttcagaatacgtaaatagttactctctctcattttccacatcctcggcattcagaggcaactgcctgccaaattatggcaacttcctctgtgttt