Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

Oligo: sjj_B0273.3_b   

sjj_B0273.3_bSequenceATTTACCGCCAAATTGAGTAGGT
In_sequence B0273
SUPERLINK_CB_II
PCR_product sjj_B0273.3
smd_F18A11.6