Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0280.9   

sjj_B0280.9 RNAi JA:B0280.9
Simmer:B0280.9
PF:GL1_4G5
PCR_productsjj_B0280.9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0280.9 Source_evidenceePCR782WS150 Sequence/Annotation Release
Overlaps_Gene B0280.9 Source_evidenceePCR782WS150 Sequence/Annotation Release
Chunk_score Abs_score635
Max_abs_score635B0280.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII71215737122708
Overlaps_transcriptB0280.9 Source_evidenceePCR782WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0280.91136cgtcggtgaatgtatgttgcgatgatttggttcccggcaatccaatgtttgcgatcacaatttggccggtctctagaaatttcgaataatttttgaatttttggcaatataaaaccaaccgcagatgatccaaatttcacggctgtgcgatgggaaaaacttgatttctgacgcatttgctgggagtgatattgttgtgatatgctccatcgactgaaacattttacatttaaacttttaatttgccaataatttaattttttgacatacagtagcatggagaacatagatgtgagaattgtgtcctgcaattgccaaaaattgagagtcatgcgaaatggcaaagagccgaattccttgctttggtactgctgtaaaatgttcaaagttttgcttcaaattttattaaatattaaacgtactgtttggaggtttcaactgtgtcacttctcttgtttccatattgtactgcatcaaatattcctttcggcttgaagaacagatcacagagtgtcctttatcagcaatttccagactatcaatcgggaattttgagaaattcgcactttgaaggaaacgatcctttttaacctcacgacttacctgaaataagtaaggaatggtttaattaaaacagaaaacacaacttactttaaaaagttgaacatttccaccttgatcggcaacaatgagcactggtcgggttttatgaaatttaacaacagtgattccacgagtgtatcggtgtccgatgttgaaatcttttataagagttgtatgaatagttgtttttggtaaattcacgtctttcgccaaatatccggcagcagttttcaacaatgacccttcttcttcgtctcctaaaattgtaaaatacgatttttgaactattgattttccaaaaacctgcagcagccttagcccattttggtgtgcctccgtggcgttttctgaacgcctcttgcaatctaccaacgtattcctaaaatattaaaattatttttcagaagtaatttatccttctgcctattttcaattatataatctttattacacgttgaataacgtatttctaaaaaaaatttacctttgaatccaattctccatgttcttcgtctgtggttcgcttgagttca