Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0336.6   

sjj_B0336.6 RNAi JA:B0336.6
Simmer:B0336.6
PF:GL1_7H3
PCR_productsjj_B0336.6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene B0336.6 Source_evidenceePCR1063WS150 Sequence/Annotation Release
Chunk_score Abs_score979
Max_abs_score979B0336.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII56909425692588
Overlaps_transcript B0336.6.2 Source_evidenceePCR1063WS150 Sequence/Annotation Release
B0336.6.1 Source_evidenceePCR1063WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0336.61647actgattctggtggaggtggtagatcatccatatcatcttgtgttggcattcgacttgacattccagtgagcaaagaatttggtggaggtggaagatcatgtcggttcaccgttgattttcgaatagttccataattttgttgttgcatttgttgttgttgttgttgttgtaccacacttcccggtgcaacatatccagtataattcatagctggtggtggaagtgggaatgttggtgattctggacctccagcactactttgtgcagatgatagtctgggaatagaaaagctaccatccactgtagtccgaccaccagctcgaatagttccgtaacgatcaggttgataaatggaattatagtctgatgatccgtgttgacttccgcttccaccaccaccgctcatatgatctccgaactctgatccgtggctcatttgacggccgattcgtgattctgattgtggtgtgacctgtaaaaagtaatcggattatgttagaaaaaacttgattaattttttgaaaaggaaatgagctgattttttaaaaattagttgtttagtctgaagtcgacaaaaactagcctgaaacattgaatttcataaaaagacttctaaaaaatttcaaaattaattatgtgattattcaataaatactgtatctaactgctgtaacaaggatttcagattcttattcaggctcgctctaaattttttttcgatattttcagaagtctcattatgaaatgcggtcgttttgggtcaaaaaaaccgttttttgaataaatttatcaatggttcacttttttttcaatattgagtgtatttttcagaaaaaaaagtttaaaatttaaaatgtataagttatgtcagaatttttcgctcccttttttttttgaaaacgttttgtcaaaaacacgaaaagcaaattattttcagcctctatgaatatttcaaatgttcacctgtggcaaccgataatccgatggagcaattgatggagcatacggtctcattgttcttcctaacgtagccgttcgttcaccagcataaactccatacgctggagattcattgtgaaattgtgatggagaactgccagaaattgatgaagttgctcttgagattggtgctgctctcggtggatccgatgttctgacaccatgccctattccgtcaagaacagaaaaatcgatgggcgttcgttgatatctctgcttttcatctgggattgctggtgcaatgattttgggttgcttgaataatgttttattggttgtgagagaaccaatttctcgtcttgcaagcttctctttatgtacatcaactacttggctaacatattgaacttgatttgttaaagagttcactttatcggtttgtagagcaagcatatcgtgtaaatctctgaaaaaaagattcataattaaaacaaattaattgaaatacttacgtaaccatcttgttaatctggtaggctacgctggcgagtgcctggatcgcgaatttcttggattcctctagcgcagcagatttattctgaaaacgtttaattcataaacttaaaagaaaaaattaaaccacacgtttgattgtatataattatcctcacaatacgcggcaacttgttgaagattcgcatgactcg