Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0391.1   

sjj_B0391.1RNAiJA:B0391.1
PCR_productsjj_B0391.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_GeneB0391.1 Chunk_score Abs_score727
Max_abs_score727B0391.1
Specificity_index1
Rel_score1
Overlaps_pseudogene B0391.1 Source_evidenceePCR736WS150 Sequence/Annotation Release
Map_statusUnique_ePCRV1562096615622095
WB_DNA_textsjj_B0391.11130aatttgatcggaggtgcttgtgagatcttccaggtacctggagaactaaagcagcaaacaactgctgctgtaaccttttcaccttgtttgattttgttgtggcgatttgagagatttttgatatgtaagagtaacactggataccgaaatatacgataaggataaaggatattgtctggaaaatattatggatagtgaaaaaagagcaaggatgaactaaaatttgtacgaatttagagacattgaagaatgctttttttttaacttgcgcttcctgatcctattaagtctcagacttcacgtaatccgactctcccacataccgtaagcacgcacaagacagatgcagctgcaagagatttgtgaatcaacgatccgtcaactggtgagtaaaataagggccctgtgtaggaaaactcgtccaacgacaaattcttctcattacgcatgaattctctgaaatacttgttacatgcaaattttaatgctaggcattacccagcaagaacatccatttctggagaattgggatacagaaaataagtacccagtgcataggctactccgtaggcaaagggcaatgcaaaccaggtcacgatttcgaagtttttgaattttttgagaatcttgtttccggttgcgacgaaggatcggtaggcaaagacaatgacaaacattcccatggaaaatccaaagaatccgcagtacgtgcctgaaatttgttagttttggtggtgatcaaatctcaaagcaagaacttacagttaaagatcattgaaacgtttttcccgaaaaatcgatctttatgaggaacaactactataaatgatggcccaatgttaaatattgtctggaaaattagaaaattcaaatagtgaaactcctatcagcaagtacttatagttgcccatttggggtggagatcggagaatgataagaaggatcaaaatggagttgaagaaaattgaagtgggtgccgtatagtacggcagagcattctgaatggcgtccattgtgaagaatgtgaagatttccgtctgattttataagatctcaagtctcaagtgtttttgcagacatatggcagacaggaaaacaataacaaaaaagtctcatacagctccgtgacg