Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: sjj_B0395.1   

sjj_B0395.1 RNAi JA:B0395.1
Simmer:B0395.1:Repeat_a
Simmer:B0395.1:Repeat_b
Simmer:B0395.1:Screen
PCR_productsjj_B0395.1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSB0395.1 Source_evidenceePCR813WS150 Sequence/Annotation Release
Overlaps_Gene B0395.1 Source_evidenceePCR813WS150 Sequence/Annotation Release
Chunk_score Abs_score666
Max_abs_score666B0395.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRX1601960616021211
Overlaps_transcriptB0395.1 Source_evidenceePCR813WS150 Sequence/Annotation Release
WB_DNA_textsjj_B0395.11606ttccattccatggtccgtatcggacaagctcatttgatctatcaagactacaccatgtctatgatgaacttcttcctagtctccggcggtggcattcttgtcggcgtagtttttgcggtagtagctgctttaggtgtcaagtaagttgtgtcattgtgaaatttgtaaatactgattaatgttctacagatggagctcgaatgtgtcagttcttcagccaattatttgcatcacagttccgtatatggcatacttgtgctcagaaattgtgcatgtttcgggaattttggggtaggaaattgaacaggacagttgaaaatagataaataaaaattgtttttttttagaattgtggtatgcggactttgcatgaaatcttatgtaactggaagtatggaagaacgagctgatatcactgtaaaatataccctgaaaacgttatcatcatggtaagatttttcctatatacatattgagtttgttttataaataatatttaaattttgcaactaaatgttttttatgtccgaattatttctgaacctaaaaatatgtagctaagtaaatcctcggtttgaaatatttgttttccggttaaatcatgttttccattcaagacatttcgtggcagatgtttaaaaagccatataaaatggttttgcaaaattcaagctattttctcaaaaaataatccaagtcataaaatacaagtaatatggacaaaattaatagaggaagggataaaccttatagatgaaaaatctaatcacgttttacacagaattacccattttcagctgtgaagctattatcttcgtattcttgggattttccatattttcaaaggatcataaatgggactttggttttgcaattgtcactgttatcacttgctttgctgccagattcctcggtatgttatttaactatcaccatattgctaaaaatcagttcattcacagttgtgttcacattaacatgggtggcaaacaagtggagaatgcaaaaaatttcactgcgagatcagacaatcatggcgtttggtggacttcgaggtgcaatttgttttggattagtgttaactatcggtaagatcctaagcttttccttttcctactttacaaaattttgcagacggagaagtagtcccggccaagccgatcatgatatccaccacattgatagtaatagtattcactgtatttattcaaggaacaatgataaagccactggtatcgtttttaaatgtgaaaattgacaatgcttatgacaagtctttattccaaagttgtattgaacatgtaggtttttttaatgtttaaaccatttaattgaagttcaactacagtcattcgaagacacaatgtgcggtgttgaagcaataattggagctcatgggcagtactacgtaagctttgaaatttaaaatctgaaatttaggcatattcaggttgaggtttattttaaaaaaatttcattaattcaaattgatacgcaggaattctaaaaactgctttttccatgtgatagaattttgggtttcaaaaatatatgcttcttgcctgtatcatgatttttggctgtatcgcagccctgtaaatgaatt